CRISPR - Conas a Oibríonn sé, Na Feidhmchláir is Fearr agus Conas é a Úsáid Leat Féin.

Is uirlis é CRISPR a úsáidtear chun DNA a chur in eagar (agus, le déanaí, RNA). Úsáidim an draoi eagarthóireachta DNA seo ar bhonn laethúil mar chuid de mo thurgnaimh leanúnacha ag Imperial College London; chuir an uirlis dlús tapa leis an luas ar féidir liom orgánaigh bheo a innealtóireacht. Ó dheireadh 2012, phléasc taighde CRISPR ar bhealach nach bhféadfadh mórán eolaithe a thuar. Tháinig saotharlanna iomlána chun cinn beagnach thar oíche a bhaineann leas as an gcóras cumhachtach eagarthóireachta DNA seo chun scagadh a dhéanamh ar ghalair agus géinte a scriosadh ar bhealach tapa beacht.

Ceann de na codanna is fearr de CRISPR is ea a éasca le húsáid. Is féidir le heolaí nua-aoiseach a bheith ag obair leis an teicneolaíocht i níos lú ná seachtain amháin - tá sé chomh tapa sin a fhoghlaim. Is féidir na seichimh do na próitéiní a bhaineann le CRISPR, lena n-áirítear Cas9 agus Cpf1, a ordú ó mhonaróir DNA (IDT, GeneArt agus níos mó) nó a ordú mar sheicheamh DNA réamhdhéanta (Addgene). Is féidir plasmids chun gRNAnna a chur in iúl a dhearadh agus a ordú chomh furasta. In orgánaigh atá ag fás go tapa, mar E. coli, is féidir géinte a mhodhnú laistigh de sheachtain trí úsáid a bhaint as an gcóras CRISPR. Níl an uirlis chumhachtach eagarthóireachta DNA seo teoranta do bhaictéir, áfach; Tá sé cruthaithe go bhfuil CRISPR éifeachtach i mbeagnach gach líne cille a tástáladh, ó bhaictéir agus archaea go lucha agus daoine. Is féidir le duine ar bith, ó dhíograiseoirí go gairmithe, foghlaim go tapa an córas a úsáid le haghaidh an iliomad feidhmchlár. San Airteagal seo, pléifidh mé an chaoi a n-oibríonn an córas dúchais CRISPR agus an chaoi a ndearnadh CRISPR a athchur mar fhóntas sa tsaotharlann. Cuirfidh mé treoir céim ar chéim ar fáil freisin ionas gur féidir leat tosú ag úsáid CRISPR tú féin agus pléifidh mé deich bhfeidhmchlár nua-aimseartha den teicneolaíocht. Más rud é, ag deireadh an ailt seo, go bhfuil fonn ort níos mó a dhéanamh fós, féach ar na hacmhainní (bun an leathanaigh).

An bhfuil sonraí tábhachtacha in easnamh orm? An bhfuil rud éigin ar an leathanach seo mícheart? Cuidigh liom an chuid seo a dhéanamh níos fearr trí nóta tráchta a fhágáil!

Conas a Oibríonn CRISPR sa Dúlra (An Pictiúr Mór)

Is córas cosanta baictéarach modhnaithe é CRISPR. Nuair a ionsaíonn baictéaróip (víris a dhíríonn ar bhaictéir) baictéar, déanann siad é sin trína DNA a instealladh tríd an mbileogán baictéarach. Is féidir leis an DNA baictéarophage seo, nuair a bhíonn sé laistigh den chill, an chill baictéarach ionrach a athchlárú agus í a mhealladh chun níos mó baictéaróip a dhéanamh. D'fhorbair baictéir, mar na fabhtóirí athléimneacha atá iontu, modhanna seiftiúla chun baictéaróip a laghdú. Ceann de na modhanna seo ná CRISPR. Gach uair a bhíonn cill baictéarach ag teacht ar bhaictéaróip nua, gearrann sí suas beagán den DNA baictéaróip ionrach agus stórálann sé ina ghéanóma féin é. Ar an mbealach sin, má bhíonn an chill baictéarach riamh ag teacht ar an gcineál sin baictéarófaíochta arís, féadfaidh sí an píosa DNA stóráilte sin a ‘tharraingt amach’ agus é a úsáid chun an t-ionróir a aithint agus a scriosadh. Úsáidtear an DNA a stórálann an baictéar mar mheicníocht chosanta chun baictéaróip a chomhrac ar an mbealach seo a leanas:

1. Ionchorpraítear DNA ón mbaictéaróip ionrach i réigiún den ghéanóm baictéarach, ar a dtugtar lócas CRISPR.

2. Le linn an chéad ionraidh baictéaróip eile, déantar DNA (A, T, G, C) sa lócas CRISPR a fhreagraíonn don ionróir baictéaróip a thras-scríobh i bpíosa gairid RNA (A, U, G, C) ar a dtugtar RNA CRISPR (nó crRNA).

3. Ceanglaíonn crRNAn le próitéin mhór (ar a dtugtar coimpléasc iarmharta) agus treoraíonn sé é chuig an DNA baictéarophage, a gcomhlánaíonn a seicheamh an t-ord crRNA. Ceanglaíonn an coimpléasc iarmharta agus a crRNA leis an DNA baictéaróip ionrach trí phéireáil bonn Watson-Crick.

Nóta: Teastaíonn an dara RNA ó roinnt córais CRISPR, ar a dtugtar tracrRNA, a chabhraíonn leis an crRNA a phróiseáil. Tá an tracrRNA comhlántach leis na crRNAnna réamhphróiseáilte. Tar éis scoilteadh ag RNAse III, foirmíonn agus treoraíonn ribonuclease, hibrideach crRNA / tracrRNA an coimpléasc éifeachtóra chun an DNA baictéaróip ionrach a dhíghrádú.

4. Gearrtar an DNA baictéaróip ionrach agus is féidir é a stóráil i lócas CRISPR le haghaidh ionradh sa todhchaí.

Nóta: Is é coimpléasc iarmharta coiteann Cas9, a sheasann do phróitéin a bhaineann le CRISPR 9. Ceanglaíonn Cas9 leis an crRNA agus tracrRNA, a threoraíonn an Cas9 chuig an seicheamh DNA iomchuí (DNA baictéarophage, sa sampla seo). Chomh luath agus a cheanglaíonn Cas9 leis an sprioc-DNA, déanann sé scoilteachta DNA le snáithe dúbailte.
Scéimreach mionsonraithe ar dhíolúine CRISPR. Ar dtús ionfhabhtaíonn baictéaróip (ar chlé uachtarach) cill baictéarach le DNA víreasach snáithe dúbailte. Ceanglaíonn an DNA seo le próitéiní CAS, a dhéanann blúirí a mháil agus a stóráil in Eagar CRISPR ionas gur féidir baictéaróip sa todhchaí a aithint. Ag an am céanna, déanann próitéiní CAS III an DNA víreasach a ghníomhachtú má tá seicheamh comhlántach san Eagar CRISPR (déanann CAS II géinte eagar CRISPR a phróiseáil ina crRNAnna, ar féidir leo ansin ceangal le CAS III agus casta CAS-crRNA a fhoirmiú). Íomhá le caoinchead James Atmos.

Conas a Oibríonn CRISPR sa tSaotharlann

Mionathraíodh an córas cosanta baictéarach ar a dtugtar CRISPR chun a fhóntas a leathnú mar uirlis eagarthóireachta géanóm, a bhuíochas den chuid is mó le saotharlann Doudna ag UC-Berkeley, an saotharlann Charpentier ag Institiúid Max Planck um Bhitheolaíocht Ionfhabhtaithe, saotharlann Zhang ag MIT agus saotharlann na hEaglaise ag Harvard, i measc go leor eile. Comhdhlúthófar cuid dá bhfionnachtana anseo mar iarracht léargas ginearálta a thabhairt ar an gcaoi a n-oibríonn CRISPR i ndáiríre chun géanóm a chur in eagar sa tsaotharlann.

Ar dtús, caithfidh na cealla atá le hinnealtóireacht treoirRNA, nó gRNA a tháirgeadh go gairid. In 2012, d’fhoilsigh grúpa Doudna páipéar san iris Science (faoi stiúir Martin Jínek) a léirigh go bhféadfaí na seichimh tracrRNA agus crRNA ón gcóras dúchais CRISPR a chomhleá i seicheamh RNA amháin, ar a thug siad gRNA, a d’fhéadfadh Cas9 a threorú. chuig réigiún ar leith sa ghéanóma. Bhí sé seo an-tábhachtach, ós rud é go meastar anois go bhfuil dearadh gRNAnna thar a bheith simplí agus gnáthach sa tsaotharlann chun Cas9 nó Cpf1 a threorú chun díriú ar sheichimh DNA.

Chomh luath agus a dhéantar gRNA a dhearadh agus a chur in iúl sa chill spéise, ceanglaíonn endonuclease (Cas9 nó Cpf1 de ghnáth) leis. Is féidir leis an gcoimpléasc iarmharta nuabhunaithe Cas9 (nó Cpf1) seicheamh sa ghéanóma ar a dtugtar móitíf in aice le protospacer, nó PAM, a aithint.

Nóta: Baineann Cas9 agus Cpf1 le haicme próitéiní Cas ar a dtugtar Aicme 2. Próitéiní móra aonair iad seo go bunúsach arb éard atá iontu il-fearainn a úsáidtear chun ceangal le gRNAnna agus ansin ciorruithe dúbailte-shnáithe a thionscnamh i DNA. Is éard atá i gcoimpléisc iarmharta Cas eile próitéiní iolracha.

Maidir le Cas9 a úsáidtear sa tsaotharlann, is gnách gurb é an t-ord PAM NGG (áit a léiríonn N aon cheann de na ceithre bhonn). Chomh luath agus a aithníonn agus a gceanglaíonn Cas9 an t-ord PAM, déanann sé a gRNA ceangailte a sheiceáil le fáil amach an bhfuil comhlántacht bun-phéireála idir an gRNA agus an snáithe DNA. Má tá an dá chomhlántach lena chéile, tionscnaítear gearradh snáithe dúbailte, snáithe dúbailte sa seicheamh DNA ag suíomh trí phéire bonn suas an abhainn ó imeall 3 'an t-ord PAM.

Gearrann DNA Cas9 faoi cheangal an gRNA cuí. gRNA = treoir RNA atá faoi cheangal ag Cas9; dsDNA = DNA dúbailte-shnáithe; PAM = móitíf cóngarach protospacer. Íomhá le caoinchead Marius Walter.

Nuair a dhéantar gearradh DNA le snáithe dúbailte, tá dhá bhealach ann do chealla an damáiste a dheisiú: siúntáil deiridh neamh-homalógach (NHEJ) nó deisiú faoi threoir homology (HDR). Tá NHEJ níos gasta, ach níos seans maith go dtarlóidh earráidí, ná HDR. Nuair a úsáideann an chill NHEJ chun an damáiste a dheisiú, is minic a chuirtear isteach núicléatíd ag briseadh an tsnáithe DNA - ciallaíonn sé seo go bhfuil damáiste buan déanta ag roinnt cealla do DNA a chuireann géine mutant, neamhfheidhmiúil in iúl. Ciallaíonn sé seo, nuair a úsáidtear CRISPR-Cas9 chun sosanna snáithe dúbailte a ghiniúint i DNA i ndaonra mór cealla, go ndéanfaidh cuid de na cealla an damáiste a mhí-athshlánú agus go mbeidh sócháin bhuana caillteanais feidhme acu sa ghéine spriocdhírithe. Is é seo aisling taighdeora géinte in orgánaigh a scriosadh go tapa agus go héifeachtúil.

Gearrscéal fada: 1) Déan cinneadh cén géine is mian leat a ghearradh. 2) Dear gRNA chun díriú ar sheicheamh sonrach PAM gar don réigiún sin. 3) Cuir in iúl go bhfuil gRNA sa chill spéise i dteannta le próitéin endonuclease mar Cas9 nó Cpf1. 4) Voila! Gearrfar an DNA ag an suíomh sin agus beidh sócháin cailleadh feidhme sa sprioc-ghéine ag cuid de na cealla mar thoradh air.

Nóta: Is féidir CRISPR a úsáid le haghaidh níos mó ná eagarthóireacht DNA amháin. Trí dhá aimínaigéad a mhodhnú sna próitéiní Cas9 agus / nó Cpf1, déantar mutants de na heinsímí sin nach bhfuil an cumas acu DNA a ghearradh. Ina áit sin, ní cheanglaíonn siad ach leis an seicheamh DNA spriocdhírithe agus is féidir iad a chlárú chun léiriú géine a ghníomhachtú nó a athshlánú ag an suíomh sin sa ghéanóma. Tugtar endonucleases easnamhach nuclease ar na próitéiní seo.
Trí íomhá a thaispeánann feidhmchláir ar leith maidir le Cas9 a bhfuil easnamh núicléas orthu (dCas9 ainmnithe). Is féidir dCas9 a chomhleá le fearann ​​gníomhachtaithe próitéine nó faoi chois chun léiriú géine a spreagadh nó léiriú géine a chur ar ais, faoi seach. Is féidir dCas9 a chomhleá le próitéin fluaraiseach, mar GFP, ionas gur féidir le taighdeoirí suíomh Cas9 atá ceangailteach le DNA a shamhlú laistigh de chealla beo. Íomhá le caoinchead Marius Walter.

An bhfuil sonraí tábhachtacha in easnamh orm? An bhfuil rud éigin ar an leathanach seo mícheart? Cuidigh liom an chuid seo a dhéanamh níos fearr trí nóta tráchta a fhágáil!

Treoir Céim ar Chéim ar CRISPR a Úsáid:

Tá sé thar a bheith simplí CRISPR a úsáid sa tsaotharlann. Cé go bhfuil go leor modhanna ann chun é sin a dhéanamh, taispeánfaidh an treoir thíos conas géine a roghnú le díriú air, gRNA a dhearadh chun an géine sin a scriosadh, agus ansin é a scriosadh i gcealla beo.

1. Déan cinneadh cén géine atá le modhnú (gearradh, gníomhachtú nó cosc). Mar shampla, cuirfimid an géine hexokinase i Saccharomyces cerevisiae. Is speiceas giosta é seo a úsáidtear go coitianta - an brú cruinn céanna a úsáidtear chun beoir a ghrúdú. Is einsím é hexokinase a dhéanann fosphorylates glúcóis mar chuid den phróiseas ceallacha ar a dtugtar glicealú. Trí hexokinase a bhaint, beidh flosc glycolytic lagaithe ag cealla giosta.

Ar dtús, faigh an seicheamh DNA de hexokinase ag baint úsáide as Bunachar Sonraí Genom Saccharomyces. Níl ort ach cuardach a dhéanamh ar aon ghéine spéise agus é a roghnú ón roghchlár anuas - is é HXK1 an t-acrainm géine le haghaidh iseagóma 1 de hexokinase.

Ón leathanach seo, íoslódáil an comhad .fsa ina bhfuil an seicheamh spéise. B’fhéidir go mbeadh sé úsáideach an DNA Genómach +/- 1kb a íoslódáil toisc go soláthróidh sé seo seicheamh códaithe iarbhír na géine spéise chomh maith le réigiúin DNA in aghaidh srutha agus le sruth. Sábháil an comhad ar do ríomhaire.

2. Déan cinneadh cén próitéin endonuclease atá le húsáid. Tá níos mó einsímí ann ná Cas9 amháin is féidir a úsáid le haghaidh innealtóireachta géanóm. Is endoribonuclease Aicme II eile é Cpf1 atá curtha in athuair le haghaidh innealtóireachta géanóm. Mar shampla, bainfear úsáid as Cas9 toisc go bhfuil sé furasta oibriú leis agus na feidhmeanna go léir atá riachtanach chun briseadh DNA a chruthú i bpróitéin amháin.

Nóta: Is féidir le Cas9 nó Cpf1 atá easnamhach ó núicléas feidhmiú mar ghníomhachtú géine nó mar fhrithbhrúiteoir géine trína chomhleá le Fearann ​​Gníomhachtaithe nó Fearann ​​faoi chois. I measc na bhfearann ​​comhghníomhachtaithe tá B42, VP16 agus VP64, agus cuimsíonn fearainn faoi chois coitianta KRAB agus Mxi1. Chun críocha an tsampla seo, ní bheidh gá leis na fearainn gníomhachtaithe agus faoi chois, toisc nach bhfuil sa sprioc ach briseadh DNA dhá shnáithe a chruthú sa ghéine hexokinase i gcealla Saccharomyces cerevisiae. Tá na céimeanna seo a leanas go léir mar an gcéanna, áfach, is cuma ar mhaith leat léiriú géine a ghníomhachtú nó sprioc-ghéine a chur in eagar - is é an t-aon difríocht ná an endonuclease a úsáidtear.

3. Dear an gRNA chun díriú ar an ngéine spéise. Tá binseáil ar cheann de go leor suíomhanna Gréasáin úsáideacha a thairgeann uirlis dheartha gRNA ionsuite. I measc na roghanna eile tá: GenScript, E-CRISP, ATUM agus Dearadh CRISPR MIT. Chun an gRNA a dhearadh, uaslódáil an sprioc-ghéine spéise (hexokinase, sa chás seo) i Benchling. Chun seo a dhéanamh, roghnaigh Fardal agus ansin cliceáil ar an deilbhín + sa chúinne uachtarach ar thaobh na láimhe deise den bharra taobh clé. Cliceáil Iompórtáil seichimh DNA agus ansin tarraing agus scaoil an comhad .fsa go dtí an scáileán aníos. Tar éis do bharra glas a bheith le feiceáil a léann Uaslódáil déanta, dún an fhuinneog. Osclófar an t-ord géine go huathoibríoch anois ar phríomhcholún an ionaid sa bhrabhsálaí.

I lárcholún do scáileáin, beidh seicheamh DNA an chomhaid .fsa allmhairithe (A, T, G agus C) le feiceáil, mar aon le sraith uimhreacha, in incrimintí de dheich, fúthu. Ó úsáideadh an Genomic DNA +/- 1kb sa sampla seo, cuimsíonn an seicheamh seo míle bunphéire DNA roimh thús na géine hexokinase i dteannta le míle bunphéire DNA ag deireadh seicheamh na géine.

Chun gRNA a dhearadh chun an géine seo a ghearradh, cliceáil an deilbhín ar thaobh na láimhe deise den scáileán. Is é seo an roghchlár CRISPR. Roghnaigh Treoracha Dearaidh agus Anailíse. Tarraingeoidh sé seo scáileán nua dar teideal Design CRISPR Guides: Guide Paramaters. Sa roghchlár seo, déan cinnte go roghnaítear treoir Aonair. Is féidir le fad treorach Cas9 fanacht ag 20. Roghnaigh géanóm an orgánaigh atá á úsáid agat; sa chás seo, an géanóm R64–1–1 (SACCER3, SACCHAROMYCES CEREVISIAE), le seicheamh PAM de NGG. Is féidir socruithe chun cinn a fhágáil gan athrú. Más mian leat, is féidir na Socruithe Comhdhéanamh Treorach faoi Ardsocruithe a mhodhnú. Athrú coitianta amháin is ea an G + C% inmhianaithe den gRNA deartha a mhéadú, toisc go bhfoirmíonn bunanna guana agus cytosine bannaí níos cobhsaí leis an snáithe sprice DNA, ach ní gá é seo a dhéanamh mar shampla. Cliceáil Críochnaigh.

Anois beidh colún nua le feiceáil ar thaobh na láimhe deise den scáileán. I bhfuinneoga na Sprioc-Réigiúin, iontráil tús an réigiúin DNA ar mhaith leat díriú air do Start agus deireadh an réigiúin DNA chun díriú ar End. Mar shampla, roghnaíodh luachanna 1100 go 1600 toisc go dtagann siad laistigh de sheicheamh códaithe hexokinase, ach go bhfuil siad treallach ar shlí eile. Nuair a iontráiltear na huimhreacha seo, cliceáil an cnaipe glas Create.

Beidh an iliomad boscaí le leithead dúbailte ar an scáileán anois agus na huimhreacha istigh iontu. Léiríonn siad seo scóir Ar-Sprioc agus Lasmuigh den Sprioc de na gRNAnna. Tá na scóir seo idir 0–100, agus 100 an ceann is fearr sa dá chás. Gintear an scór On-Target bunaithe ar thurgnaimh a d’fhoilsigh John G. Doench agus Nicolo Fusi in 2016, inar thástáil siad éifeachtúlacht na mílte gRNA chun rialacha a chinneadh chun na dearaí gRNA is fearr a thuar. Tugann scór ard Ar an Sprioc le fios go gceanglóidh an gRNA go maith in aice le seicheamh PAM ar leith. Tugann scór íseal Lasmuigh den Sprioc le fios go bhfuil seichimh DNA cosúil le do sprioc-ghéine in áiteanna eile sa ghéanóma agus, dá bharr sin, d’fhéadfadh an gRNA ceangal le seichimh DNA iolracha, agus éifeachtúlacht laghdaithe dá bharr.

Chun scóir cruinn Lasmuigh den Sprioc a fháil i mBinseáil, is gá Réigiún an Ghéanóim den ghéine a bhfuiltear ag díriú air a roghnú (hexokinase, sa sampla seo). Chun seo a dhéanamh, cliceáil ar No Region Set under Genome Region. Beidh scáileán dialóige le feiceáil. Cliceáil ar an gcnaipe Find Genome Matches agus tuarfaidh an uirlis nifty Benchling go huathoibríoch cá as a dtagann an géine a iontráladh (hexokinase) sa ghéanóma giosta.

Sa chás seo, tá dhá réigiún géanóm le feiceáil; ceann ar chrómasóim 6 agus ceann eile ar chrómasóim 7. Tá an t-iseagómaim heicsokinase 1 a roghnaíodh don sampla seo ar chrómasóim 6 ag suíomhanna 255,049–253592, mar sin is é an chéad rogha an ceann ba chóir a roghnú. Is é an dara rogha, crómasóim 7, hexokinase eile, ar a dtugtar hexokinase isoenzyme 2.

Cliceáil ar an rogha chuí don ghéine spéise agus bhuail Set Genome Region. Déanfaidh sé seo na scóir lasmuigh den sprioc do na gRNAnna a nuashonrú. Anois ní gá ach gRNA a roghnú sa réigiún atá ag teastáil le scór maith Ar-agus-Sprioc. Mar shampla, roghnaíodh gRNA ag seasamh 1297 sa seicheamh géine hexokinase a iontráladh, leis an seicheamh GTCGTGTTGGTCAAGTTGAG mar gheall ar a scóir arda Ar-agus Lasmuigh den Sprioc (70.2 agus 99.8, faoi seach). Nuair a roghnaítear an gRNA (nó gRNAnna) atá ag teastáil, cliceáil Assemble.

4. Cuir an Veicteoir Slonn gRNA le chéile i do bhrabhsálaí. Tar éis duit an gRNA atá ag teastáil a roghnú agus cliceáil ar Assemble, beidh leathanach nua le feiceáil ar thaobh na láimhe deise den bhrabhsálaí. Seo nuair is féidir rudaí a dhéanamh rud beag níos casta toisc go bhfuil difríocht idir veicteoirí slonn éagsúla (nó plasmidí, na giotáin DNA a tháirgeann an Cas9 i ndáiríre) bunaithe ar an orgánach atá á innealtóireacht. Ó tharla go bhfuil S. cerevisiae á mhodhnú go géiniteach mar shampla, ba cheart veicteoir sainráite a optamaíodh le haghaidh giosta a roghnú. Trí chliceáil ar Roghnaigh Veicteoir, beidh cúpla rogha plasmid éagsúla le feiceáil. Chuir saotharlann Feng Zhang ag MIT na veicteoirí ar an liosta seo ar fáil. Tá gach ceann de na plasimídí ar an liosta difriúil - tá roinnt Cas9 easnamhach ó núicléas (le haghaidh gníomhachtú géine nó faoi chois, mar a pléadh roimhe seo) agus tá cuid eile optamaithe le haghaidh eagarthóireacht CRISPR i gcealla mamacha. Chun críocha an taispeántais seo, uaslódáilfear plasmid nua atá optamaithe le haghaidh giosta.

Ar dtús, cliceáil ar Uaslódáil plasmid nua agus ansin tarraing agus scaoil comhad seicheamh DNA. Is stór plasmid neamhbhrabúis é Addgene ina bhfuil seichimh do na mílte plasmids a chuireann Cas9 nó endonucleases eile in iúl. Sa sampla seo, úsáidfear an plasmid pML107 ó shaotharlann John Wyrick. Cuireann an plasmid seo Cas9 in iúl agus tá ‘sliotán’ ann chun an gRNA a roghnaíodh i gCéim 3. Faoi Eolas Seicheamh, cliceáil ar Seichimh Taisceora: Iomlán. Beidh leathanach nua le feiceáil le seicheamh iomlán DNA an plasmid. Cliceáil ar GenBank, a íoslódálfaidh cineál comhaid .gbk atá comhoiriúnach le Benchling. Tarraing agus scaoil an comhad plasmid seo chuig Benchling.

Plasmid pML107 ó Stór Addgene Plasmid. Tá seicheamh géine Cas9 i gcorcra.

I Benchling, bíodh leisce ort Ainm Seicheamh a sholáthar don plasmid a uaslódáladh. Ansin, roghnaigh Fillteán laistigh de Benchling chun an veicteoir slonn gRNA Cóimeáilte a shábháil. Ar dtús, áfach, is gá treoir a thabhairt do Benchling maidir le cén áit sa seicheamh plasmid uaslódáilte ba chóir an gRNA a chur isteach. Tá an próiseas seo ag brath ar einsímí srianta, ar féidir leat níos mó a léamh fúthu anseo. Tríd an seicheamh plasmid a uaslódáil i Benchling (i bhfuinneog ar leithligh), tá sé simplí anailís a dhéanamh ar an seicheamh DNA agus suíomhanna srianta a aithint a d’fhéadfaí a úsáid chun an gRNA a chur isteach. Oftentimes, sonróidh an leathanach plasmid ar Addgene freisin an áit laistigh den plasmid chun an gRNA a chur isteach. Nuair a chuirtear an fhaisnéis seo isteach i bhfuinneog Benchling, cliceáil Assemble. Sábhálfar an plasmid abairt gRNA agus Cas9 tógtha anois chuig an bhfillteán sonraithe agus beidh sé le feiceáil sa cholún lár freisin mar sheicheamh DNA.

5. Cóimeáil an plasmid ag an mbinse! Chun seo a dhéanamh, teastaíonn na hábhair seo a leanas:

a. Veicteoir léirithe - plasmid a tháirgeann Cas9 agus an gRNA deartha. Liostaíonn Addgene praghsanna ar an leathanach gréasáin do gach plasmid; Cosnaíonn pML107 $ 65. Seoltar an plasmid trí fheadán ina bhfuil baictéir bheo. Caithfear na baictéir a scriosadh agus an plasmid a aonrú trí miniprep nó clóraform: eastóscadh feanóil. Is féidir treoracha maidir le gach ceann de na turgnaimh seo a dhéanamh a fháil ar líne.

b. An gRNA deartha ag Benchling nó uirlis eile bunaithe ar an ngréasán. Tá sé thar a bheith saor DNA a ordú. Tá go leor déantúsóirí DNA ann, lena n-áirítear IDT agus GeneArt. Tá bealaí díreacha ag IDT fiú chun gRNAnna a ordú le haghaidh eagarthóireacht CRISPR ar a leathanach gréasáin. Cosnaíonn ordú gRNA (seicheamh DNA) níos lú ná $ 10. Déan cinnte, agus an gRNA á ordú agat, go gcuireann tú suíomhanna srianta san áireamh lena chur isteach sa veicteoir slonn.

c. Einsímí srianta chun an veicteoir slonn agus an gRNA a ghearradh agus seichimh forluiteacha DNA a ghiniúint dá dtionól. Is é New England Biolabs an ceannaire domhanda in einsímí srianta, ag tairiscint na céadta rogha éagsúil in éineacht le maoláin optamaithe. Cosnaíonn an chuid is mó de na heinsímí srianta faoi $ 70 agus tá maoláin níos saoire fós.

d. Imoibrithe ilghnéitheacha. Teastaíonn einsímí eile, ó ligase DNA (chun an veicteoir slonn agus gRNA a dheisiú tar éis dóibh a bheith ceangailte) agus maoláin (chun timpeallachtaí cobhsaí a choinneáil chun an DNA a ionramháil) go feadáin phlaisteacha agus pípéad.

e. Cealla chun innealtóra. Mar shampla, caithfear S. cerevisiae a fháil. Ar ámharaí an tsaoil, tá cealla saor áiféiseach nó, de ghnáth, go hiomlán saor in aisce.

Nuair a bheidh na himoibrithe riachtanacha go léir i bhfeidhm, bain úsáid as na heinsímí srianta chun an gRNA agus an veicteoir slonn a ghearradh agus ansin ceangail an dá phíosa DNA le heinsím ligase. Chun treoracha mionsonraithe a fheiceáil chun clónáil a dhéanamh sa bhitheolaíocht mhóilíneach, is acmhainn iontach é Acadamh Khan.

6. Innealtóir na gCill! Tar éis an veicteoir slonn a chruthú (a chuireann Cas9 agus an gRNA deartha in iúl anois), tá sé thar am an veicteoir slonn a fháil taobh istigh de chealla beo. Tá an próiseas seo níos simplí ná mar a shamhlófá agus is próiseas é ar a dtugtar claochlú. Tá sé níos éasca agus níos tapa baictéir a athrú ná cealla eocaryotic.

Chun S. cerevisiae a athrú, lean an prótacal tapa iomasach seo ar líne. Chun éifeachtúlacht claochlaithe níos airde a bhaint amach, is dócha go mbeidh prótacal claochlaithe níos doimhne ag teastáil. Is féidir iad seo a fháil ar líne freisin.

Tar éis an prótacal a sheoladh agus an giosta claochlaithe a chothú ag 30⁰C, tógann sé thart ar dhá lá do choilíneachtaí giosta a bheith i láthair. Is féidir na coilíneachtaí seo a scagadh agus a thástáil trí mhodhanna éagsúla a úsáid - beidh roinnt de na coilíneachtaí ina mbuaiceanna de hexokinase (nó an géine a roghnaíodh), cé gur cheart turgnaimh a dhéanamh chun a dheimhniú gurb amhlaidh atá.

Na 10 iarratas CRISPR is fearr:

1. Diagnóisic pataigin.

Tá foireann eolaithe ag MIT ag baint úsáide as CRISPR chun pataiginí a bhrath go tapa agus go saor. Faoi stiúir na nOllúna James Collins agus Feng Zhang, tá córas nua CRISPR a dhíríonn ar RNA, seachas DNA, ar a dtugtar SHERLOCK (Díghlasáil Tuairisceoir Einsímeach Ard-íogaireachta Sonrach) á úsáid chun seichimh víreasacha agus baictéaracha a bhrath. Baineadh úsáid as an teicneolaíocht seo chun idirdhealú a dhéanamh idir amhrán Afracacha agus Meiriceánacha den víreas Zika agus is féidir léi géinte a bhfuil baint acu le frithsheasmhacht in aghaidh antaibheathach a bhrath ó iliomad amhrán baictéarach.

2. Scagadh ailse.

Tá eolaithe ag Ionad Ailse agus Neamhoird Fola Leanaí Dana-Farber agus Boston i mBostún ag baint úsáide as CRISPR-Cas9 chun na mílte géinte a bhfuil baint acu le foirmiú meall i lucha a scagadh. Trí fibroblasts a bhaint ó lucha agus gach géine sa ghéanóma a scriosadh ceann ar cheann sna cealla seo (trí gRNAnna a úsáid atá dírithe ar gach géine a dhíriú go comhthreomhar), is féidir le heolaithe méideanna iontacha sonraí a bhailiú a phéinteálann pictiúr a bhfuil géinte bainteach leis ailse agus conas is féidir cógaisíocht a dhíriú orthu.

3. Innealtóireacht mheitibileach agus déantúsaíocht comhdhúile ardluacha.

Tá cáil idirnáisiúnta ar shaotharlann Jay Keasling ag UC-Berkeley i réimse na hinnealtóireachta meitibileach, disciplín a athdhéanann meitibileacht orgánaigh chun ceimiceáin agus bithbhreoslaí ardluacha a tháirgeadh ó ábhair tosaigh saor, mar shiúcraí. Thosaigh grúpa Jay Keasling le déanaí ag baint úsáide as CRISPR le endonucleases atá easnamhach ó núicléas (Cas9 agus Cpf1 a chaill an cumas DNA a ghearradh, agus ina ionad sin léiriú géine a ghníomhachtú nó a athshlánú) chun meitibileacht orgánaigh a athfhriotal ar bhealach atá i bhfad níos gasta ná na modhanna a úsáideadh roimhe seo.

4. Múnlaí luiche / scriosadh géine.

Tá sé níos éasca cnagadh géine a dhéanamh ná riamh, agus tá an teicneolaíocht á cur i bhfeidhm cheana féin chun lucha dearthóra nach bhfuil géinte ar leith acu a ghiniúint. Is samhlacha úsáideacha iad na hainmhithe seo chun staidéar a dhéanamh ar dhul chun cinn galar le haghaidh tinnis casta daonna, lena n-áirítear Alzheimer, diaibéiteas agus ailsí. Déanann Jackson Laboratories, ceann de na ceannairí domhanda in eagarthóireacht géanóm luch, cur síos ar thrí mhodh éasca chun lucha a chruthú le scriosadh géine ar a suíomh Gréasáin.

Sócháin dhíobhálacha i suthanna a cheartú.

Tuairiscíodh go hoifigiúil in 2017 gur úsáideadh CRISPR chun géanóm daonna a chur in eagar sna Stáit Aontaithe chun siondróm Hunter a cheartú in othar 44 bliain d’aois, cé go bhfuil an tSín ag úsáid na teicneolaíochta chun suthanna daonna a chur in eagar ó i bhfad níos luaithe (ar dtús) tuairiscithe Aibreán 2015). I mbliana, cuirfear tús oifigiúil le heagarthóireacht CRISPR ar thrialacha othar daonna san Eoraip, faoi cheannas CRISPR Therapeutics, cuideachta atá lonnaithe i Cambridge, Massachusetts.

6. Eagarthóireacht ghéanóma CRISPR le haghaidh pórú ainmhithe feabhsaithe.

Is féidir CRISPR-Cas9 a úsáid chun DNA a mhodhnú le sainiúlacht agus beachtas gan fasach, rud a ligeann d’fheirmeoirí ainmhithe a bhfuil tréithe inmhianaithe acu a phórú i bhfad níos gasta ná na gnáthchláir phórúcháin. Tá go leor imní eiticiúla ann a bhaineann le modhnú géiniteach beostoic lena dtomhailt agus déantar díospóireacht ghníomhach fós ar na feidhmchláir phaitinn a bhaineann le húsáid CRISPR le haghaidh innealtóireachta beostoic.

7. Tiomáineann Gene malaria a dhíothú.

Le blianta fada, tá iarracht idirnáisiúnta déanta ag Fondúireacht Bill & Melinda Gates chun tiomántáin géine a fhorbairt a fhéadann mosquitoes a iompraíonn paraisítí a dhíothú. Ní iompraíonn an plasmodium is cúis le maláire ach mosquitoes baineann de speicis áirithe. Ar dtús, déantar innealtóireacht ar mhoscítí baineann chun an tiomántán géine a iompar ar cheann dá chrómasóim '. Nuair a scaoiltear an baineann seo isteach sa daonra agus nuair a phóraíonn sí le mosquito fireann, seachadtar an tiomáint géine chuig an sliocht (ní bhfaighidh ach 50% den sliocht an tiomáint géine). Tar éis roinnt glúnta, is féidir leis an tiomáint géine scaipeadh go tapa ar fud an daonra. Chun níos mó a fhoghlaim faoin gcaoi a n-oibríonn tiomántáin géine CRISPR-Cas9, féach ar an beochan seo ó Institiúid Wyss in Ollscoil Harvard.

8. Tréithe in orgánaigh bheo a mhodhnú (lena n-áirítear sciatháin féileacán).

Ós rud é gur féidir CRISPR a úsáid chun léiriú géine a ghníomhachtú nó a athshlánú, is féidir é a úsáid chun lasca géine a smeach 'ar' agus 'as' ag amanna roghnaithe le linn na forbartha. Bhain taighdeoirí leas as an gcumas seo chun forbairt patrúin sciatháin i bhféileacáin a rialú. Nocht an staidéar, a foilsíodh in Imeachtaí Acadamh Náisiúnta na nEolaíochtaí, máistir-lasc géine a rialaíonn foirmiú patrún i bhféileacáin agus a d’fhéadfadh próisis fhorbartha in orgánaigh eile a rialú freisin.

9. Teiripe cille; go háirithe teiripí CAR T-chill.

Tá CRISPR á úsáid chun imdhíteiripe ailse a fheabhsú. D'úsáid roinnt saotharlann an teicneolaíocht chun T-chealla a bhaintear as othair le hailse a innealtóireacht. Trí ghéinte ar leith a chur sna T-chealla, is féidir iad a ‘ríomhchlárú’ chun tumaí a fhiach agus a ionsaí laistigh den othar. Tá dornán cuideachtaí tagtha chun cinn sa spás seo; le déanaí, fuair Gilead Sciences agus Kite cuideachta ar a dtugtar suas le $ 567 milliún cuideachta darb ainm Cell Design Labs (a bhunaigh Wendell Lim, Ollamh le Cógaseolaíocht Cheallach agus Mhóilíneach in Ollscoil California, San Francisco).

10. An Mamó Olann a thabhairt ar ais!

Tá cáil idirnáisiúnta ar George Church agus a shaotharlann ag Harvard; Bhí lámh ag Church i múnlú beagnach gach rud a bhaineann le teicneolaíochtaí nua-aimseartha seicheamhú agus sintéise DNA. B’fhéidir go bhfuil cáil air (sna meáin ar a laghad), áfach, as a chuid aidhmeanna an mamó olla a thabhairt ar ais. Baineadh úsáid as teicneolaíochtaí eagarthóireachta DNA cheana féin chun speicis atá imithe as feidhm, mar an Pyrenean ibex a thabhairt ar ais, ach is fadhb i bhfad níos déine í an mhamach olann go páirteach mar gheall go bhfuil díghrádú DNA ann, thar na mílte bliain. Dá bhrí sin, is gá an DNA a bhaintear as gruaig mhamach olann, craiceann agus cnámha a dheisiú sular féidir é a chur isteach i suth inmharthana. Déanfaidh CRISPR an próiseas seo a shimpliú agus a shruthlíniú.

An mamó olann imithe as feidhm. Íomhá le caoinchead Flying Puffin (Mammoth arna uaslódáil ag FunkMonk) [CC BY-SA 2.0 (https://creativecommons.org/licenses/by-sa/2.0)], trí Wikimedia Commons.

An bhfuil sonraí tábhachtacha in easnamh orm? An bhfuil rud éigin ar an leathanach seo mícheart? Cuidigh liom an chuid seo a dhéanamh níos fearr trí nóta tráchta a fhágáil!

Conas a tháinig feabhas ar CRISPR le Dhá bhliain anuas:

Seo iad na cúig nuashonrú is fearr ar an gcóras CRISPR, agus mhaolaigh gach ceann acu laigí riachtanacha atá i láthair sa chóras eagarthóireachta géine CRISPR bunaidh.

1. Sainiúlacht PAM níos leithne. Príomhtheorannú mór ar CRISPR is ea a spleáchas ar sheichimh PAM - endonuclease: ní féidir le coimpléasc gRNA ceangal ach in aice le seicheamh PAM (do Cas9, is é seo NGG, áit a léiríonn N aon cheann de na ceithre bhonn DNA). Maolaíonn páipéar le déanaí san iris Nature le saotharlann David Liu an teorannú seo. D’fhorbair siad foirm nua den phróitéin Cas9 a bhfuil sainiúlacht PAM níos leithne aige, rud a chuir ar chumas taighdeoirí díriú ar gRNAnna chuig líon suíomhanna atá ag síormhéadú laistigh den ghéanóma.

2. Cas9 Teirmeach. Cé nach bhfuil sé riachtanach d’fheidhmiú CRISPR, bheadh ​​sé úsáideach go mbeadh endoribonucleases, mar Cas9 agus Cpf1, atá in-theirmeach - is é sin, fanann siad gníomhach fiú ag teochtaí arda. Is é seo go díreach a chuir saotharlann Jennifer Doudna ag UC-Berkeley i gcrích in 2017. Léirigh siad fiú go raibh an fhoirm nua seo de Cas9 níos cobhsaí i bplasma fola an duine, agus ar an gcaoi sin a éifeachtúlacht a mhéadú mar uirlis eagarthóireachta géine féideartha i ndaoine.

3. GRNAanna ilphléacsála. Laigeacht mhór amháin atá ag córais CRISPR faoi láthair ná go gcuirtear gRNAnna in iúl go hiondúil ag an am, ag teorannú an chórais go modhnú amháin in aghaidh an ghlúin cheallaigh. Chun na céadta, nó fiú na mílte, modhnuithe géiniteacha a dhéanamh ar chill, thógfadh córais nua-aimseartha CRISPR tamall maith fós (cé nach mbeadh siad chomh fada le modhanna bitheolaíochta móilíneacha stairiúla). Bealach amháin le dul i ngleic leis an easnamh seo is ea gRNAnna ilphléacs a dhéanamh - is é sin, bealaí a aimsiú chun go leor, go leor gRNAnna a dhíríonn ar il-réigiúin an ghéanóim a chur in iúl i gcill amháin ag an am céanna. Tá cúpla bealach ann chun gRNAanna ilphléacs a dhéanamh; modh coiteann sa lá atá inniu ann ná splicing intron, ina gcuirtear gRNAnna in iúl ó thionscnóir aonair agus tá seichimh intron taobh le gach gRNA. Ansin glanfaidh an chuid is mó de na cealla eocaryotic na seichimh intron seo, ag scaoileadh na gRNAnna. Níor éirigh le taighdeoirí níos mó ná cúpla gRNA a chur in iúl ó lócas amháin, ach tá feabhsuithe gasta don chóras CRISPR mar thoradh ar fhorbairtí sa réimse taighde seo.

4. Eagarthóireacht CRISPR ar RNA. Díríonn córais CRISPR ar DNA. Ach cad a tharlódh dá mbeimis ag iarraidh athruithe a dhéanamh ar RNA? Seo go díreach atá curtha i gcrích ag saotharlanna ag MIT leis an gcóras nua SHERLOCK. Tá paitinní déanta ag saotharlanna James Collins agus Feng Zhang ar an teicneolaíocht, a úsáideann endonuclease nua, ar a dtugtar Cas13, is féidir a úsáid chun DNA agus RNA a bhrath. Foilsíodh an córas i mí Feabhra na bliana 2018 ag na príomhúdair Jonathan Gootenberg agus Omar Abudayyeh san iris Science. Tá acmhainneacht nár úsáideadh fós i ndiagnóisic pataigin, dearadh ciorcad agus cur i bhfeidhm i gcealla beo, agus go leor eile, ag baint úsáide as córais CRISPR ar RNA.

5. Córais CRISPR trí fheidhm. Is féidir córais iolracha CRISPR a úsáid go comhuaineach laistigh den chill chéanna - trí go leor endonucleases agus gRNAnna a chur in iúl ag an am céanna, is féidir go leor ‘feidhmeanna’ éagsúla a dhéanamh sa chill go tapa agus go sonrach. Trí Cas9, Cas9-easnamhach Cas9 agus Cpf1 easnamhach nuclease i giosta (in éineacht le trí gRNA, ceann do gach ceann de na endonucleases) a chur in iúl, d’éirigh le saotharlann Huimin Zhao in Ollscoil Illinois (Urbana-Champaign) trí cinn a ghníomhachtú, a chosc agus a scriosadh. géinte uathúla taobh istigh de chealla ag an am céanna. Níl aon teorainneacha ann go dtí seo maidir le líon na n-endonucleases agus gRNAnna is féidir a chur in iúl, ach tá eolaithe ag iniúchadh go tapa na teorainneacha teoiriciúla agus turgnamhacha!

An bhfuil ábhair thábhachtacha léitheoireachta in easnamh orm? An bhfuil aon fhoinsí ann a mholann tú? Cuidigh liom an chuid seo a dhéanamh níos fearr trí nóta tráchta a fhágáil!

Cá háit le Níos Mó a Fhoghlaim Faoi CRISPR:

Murar thuig tú gach rud san alt seo, ná fret. Is féidir an milleán a chur ar aon bhearnaí a d’fhéadfadh a bheith ann i d’eolas ar mo chuid mínithe agus ní ar do inniúlacht. Ar ámharaí an tsaoil, tá an iliomad acmhainní iontacha ann chun níos mó a fhoghlaim faoi CRISPR, a fheidhmeanna, a stair nó a thodhchaí. Tá cúpla acmhainn ardchaighdeáin curtha san áireamh agam anseo chun cabhrú leat ar do thuras eagarthóireachta géine!

1. Crack in Creation: An Chumhacht Nua chun Éabhlóid a Rialú le Jennifer A. Doudna agus Samuel Sternberg. Is dócha gurb é an leabhar seo le déanaí (a foilsíodh díreach anuraidh) an áit is fearr le díograiseoir níos mó a fhoghlaim faoi CRISPR. Scríobhtar an leabhar i dtreo lucht féachana ginearálta agus míníonn sé a stair, a fhorbairt agus a fheidhmeanna.

2. Teorainn nua na hinnealtóireachta géanóm le CRISPR-Cas9 le Jennifer A. Doudna agus Emmanuelle Charpentier. Seo alt san iris Science a dhéanann sár-obair chun CRISPR a mhíniú, agus é a chur i gcomparáid le huirlisí a úsáideadh roimhe seo chun DNA a chur in eagar. Tá an t-alt curtha in oiriúint d’eolaithe nó do dhíograiseoirí CRISPR. Ní éiríonn sé níos fearr ná éisteacht le beirt de bhunaitheoirí faoi CRISPR!

3. Treoir Addgene CRISPR. Is dócha gurb é seo an treoir dheifnídeach CRISPR - clúdaíonn sé beagnach gach rud a bhaineann le CRISPR, lena n-áirítear conas é a úsáid, treoracha a dhearadh, endonuclease a roghnú, agus gach rud eile. Cuireann Addgene, an stór plasmid neamhbhrabúis a scríobh mé faoi níos luaithe san alt seo, acmhainní neamhionanna ar fáil do chórais CRISPR. Scríobhtar na hailt d’eolaithe ach, le cúlra leordhóthanach, ní bheidh aon trioblóid agat na hacmhainní Addgene seo a thuiscint.

4. CRISPR / Cas9 & Eagarthóireacht Spriocdhírithe ar Ghéanóim: Ré Nua i mBitheolaíocht Mhóilíneach le New England Biolabs. Treoir mhionsonraithe, ach ghairid, ar CRISPR, le béim ar leith ar na meicníochtaí móilíneacha atá taobh thiar de CRISPR-Cas9 (mar shampla, an chaoi a ndéanann an cill an gearradh dúbailte snáithe DNA agus a dheisiú). Cuimsíonn an t-alt roinnt turgnaimh freisin ar féidir le taighdeoirí a úsáid chun a gcórais CRISPR a thástáil.

5. CRISPR-Cas: Lámhleabhar Saotharlainne le Jennifer A. Doudna agus Prashant Mali. Clúdaíonn an téacsleabhar seo beagnach gach úsáid de CRISPR le treoracha mionsonraithe céim ar chéim maidir leis an teicneolaíocht a úsáid chun DNA a chur in eagar, géinte a ghníomhachtú nó a athshlánú, agus go leor feidhmchlár eile. Is treoir turgnamhach deifnídeach é seo chun CRISPR a thuiscint agus a chur i bhfeidhm.

Tagairtí:

  1. Addgene CRISPR Guide: Seicheamh PAM

2. Córas CRISPR trí fheidhm, saotharlann Huimin Zhao.

3. Cas9 athraithe le sainiúlacht leathan PAM, saotharlann David Liu.

4. Córas SHERLOCK, CRISPR le haghaidh eagarthóireacht RNA, saotharlanna James J. Collins agus Feng Zhang.

5. “Feidhmiú theicneolaíochtaí CRISPR i dtaighde agus níos faide anonn” le Rodolphe Barrangou agus Jennifer A. Doudna.

6. “Cas9 in-theirmeach le saolré méadaithe i bplasma daonna” ag saotharlann Jennifer A. Doudna.

7. Uirlis Dearaidh gRNA agus Tuar Scór Lasmuigh den Sprioc

8. “Dearadh sgRNA optamaithe chun gníomhaíocht a uasmhéadú agus éifeachtaí lasmuigh den sprioc de CRISPR-Cas9 a íoslaghdú” le saotharlanna Jennifer Listgarten & David E Root.

9. Cell SnapShot: Córais CRISPR-Cas Aicme 2 le Kira S. Makarova, Feng Zhang agus Eugene V. Koonin.